Arbeidsbok

Biologiske spor (Gå til denne siden)

Oppgave 1

Politiet har sikret seg biologiske spor fra åstedet. Hva slags biologiske spor tror dere politiet kan ha funnet? Gi minst fire forslag.

Ikke besvart

Arbeidsrutiner (Gå til denne siden)

Oppgave 2

Hva tror dere kan skje hvis politi eller rettsgenetikere ikke bruker hansker/beskyttelsesdrakt når de samler eller arbeider med biologisk materiale fra åsted eller mistenkte?

Ikke besvart

PCR (Gå til denne siden)

Oppgave 3

Vi vil kopiere dette området på DNA-tråden med PCR:

ATTCGACCCAGAGATAGATAGATAGAT ......

Hvordan skal primeren for starten av området se ut? 

 

Ikke besvart

Oppgave 4

Forklar med egne ord hvilken funksjon primeren har i PCR.

Ikke besvart

Oppgave 5

Hvor mange forskjellige primere trenger vi for å lage kopier av 17 ulike områder på DNA?

Ikke besvart

Oppgave 6

Hvorfor er temperaturregulering viktig i PCR?

Ikke besvart

Oppave 7

Hvorfor trenger vi å bruke PCR når vi skal få fram en DNA-profil?

Ikke besvart

DNA-profil fra åstedet (Gå til denne siden)

Oppgave 8

Bruk resultatene fra elektroforesen til å fylle inn feltene som mangler i DNA-profilen fra åstedet.

Område 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
Åsted XY 11-17 6-9 30-32 10-15         11-16 16-17 12-14 21-23 10-10 21-23 13-14 27-19

 Skriv inn svarene i tekstboksen under.

Ikke besvart

Har vi funnet tyven? (Gå til denne siden)

Disse oppgavene bør oppsummeres i hele klassen.

.

 

Dette er DNA-profilene som rettsgenetikerne sendte over til politiet av de tre mistenkte. Sammenlign med DNA-profilen fra åstedet og se om dere får noe treff.

Område 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
Ira Johnsen XX 11-17 6-9 30-32 10-15 11-15 17-17 21-24 9-11 8-15 15-19 12-13 21-22 9-9 21-24 12-15 26-30
Peter P. Fix XY 11-17 6-9 30-32 10-15 13-16 16-16 19-26 10-12 11-16 16-17 12-14 21-23 10-10 21-23 13-14 27-19
Tim Saltar XY 11-17 6-9 30-32 10-15 13-14 12-18 24-27 8-13 10-16 12-19 11-15 20-20 9-10 20-21 11-14 28-28

 

Oppgave 9

Hvem sin sigarettsneip ble funnet på åstedet?

Ikke besvart

Oppgave 10

Den mistenkte nekter for å ha begått innbruddet. Hva tror du den mistenkte kan ha som forklaring på at sneipen ble funnet i innbruddslokalet? 

Ikke besvart

Oppgave 11

Tenk deg at du er en journalist i Morgenavisa. Lag en avisoverskrift og en ingress til en ny artikkel i avisa som tar utgangspunkt i resultatet fra DNA-analysen. Les gjerne avisartikkelen fra Morgenavisa for å få noen tips.

Ikke besvart

Oppgave 12

Hvilke biologiske spor tror dere fungerer best som bevis i en rettssak: hår, blodspor eller sigarettsneip? Begrunn svaret.

Ikke besvart

DNA-registeret (Gå til denne siden)

Oppgave 13

Hva er lagret i DNA-registeret?

Ikke besvart

Oppgave 14

Hvem mener dere bør være registrert i DNA-registeret?

Ikke besvart

Bruk av gentester (Gå til denne siden)

Oppgave 15

Hva kan vi oppnå med å ta en gentest som kartlegger utseende / geografisk opphav til kvinnen vi mistenker?

Ikke besvart

Oppgave 16

Tenk deg at en gentest viser at kvinnen er asiatisk. Hvilke konsekvenser tror du det kan ha hvis denne informasjonen blir spredd i media?

Ikke besvart

Bruk av slektsforskningsregistre (Gå til denne siden)

Disse oppgavene bør oppsummeres i hele klassen.

.

Oppgave 17

Studer slektstreet og prøv å tenk dere til hva som har skjedd. Hvem tror dere står bak innbruddet på Majorstua i Oslo og i Bergen? 

Ikke besvart

Oppgave 18

Hvem vil dere kalle inn for å avgi celleprøve for å få laget en DNA-profil, slik at dere kan få et mer sikkert bevis?

Ikke besvart

Oppgave 19

Tenk deg at du er en krimforfatter som ønsker å bruke denne saken som utgangspunkt for din neste bok. Prøv å finne et godt plott der løsningen er litt innviklet og som f.eks. involverer planting av bevis.

Ikke besvart

Oppgave 20

I Norge er det ikke lov å bruke slektsforskningsregistre i etterforskning, men i noen land er det tillatt. Synes dere det er greit at politiet bruker slektsforskningsregistre hvor de i prinsippet kan identifisere nesten alle personer? Begrunn svaret.

Ikke besvart